10 Very Long Words You Don't Know

by on April 21, 2009

In choosing to provide a list of long words that you (or at least most of you) don’t know, I decided to eschew two very specific words: antidisestablishmentarianism and floccinaucinihilipilification – my presumption being that you will have run into both of them. When I was at school, I was unreliably informed that the longest English word was the first of these two, and later, when I went to university, I was unreliably corrected, when told that the longest English word was in fact the second of these two.

Antidisestablishmentarianism has 28 letters and can be blamed on the marital difficulties of Henry VIII, who, when forbidden to get a divorce by Pope Clement VII, set himself up as “Pope of the English Church” thus inconveniently linking the English church directly to the state. By the 19th century some British politicians had begun to conclude that this linkage was a bad idea (suffering perhaps from America envy) and they became known as disestablishmentarians. Naturally, other politicians opposed this and thus talked-the-talk as antidiestablishmentarians.

Floccinaucinihilipilification noses ahead of antidisestablishmentarianism by a single letter and it is a lot easier to define. It means the categorizing of something as worthless trivia. For example, my definition of antidisestablishmentarianism could, and probably should, be floccinaucinihilipilificated.

Both of these words were put into the shade by the Mary Poppins song; Super­cali­fragi­listic­expi­ali­docious, which a word of 34 letters. Technically this is a nonsense word, but if you believe the words of its song, this is a word that is properly used only if you can’t think of anything to say. Thus it is always used improperly, since if you can’t think of some thing to say, and you think to use this word, then you can think of something to say and hence shouldn’t say it.

  1. Pseudoantidisestablishmentarianism. Let’s face it, this word is just a cheat. Technically, of course, it means “a feigned opposition to the separating of the state from the Church” and, at 34 letters, it draws level with the Mary Poppins nonsense. But really? Why not pseudofloccinaucinihilipilification? (feigning to categorizing of something as worthless trivia) or pseudosuper­cali­fragi­listic­expi­ali­docious (a word you say when you actually can think of something to say, but want to give the impression that you can’t think of something to say.)
  2. Hippopotomonstrosesquippediliophobia. This word is blatantly intimidating and was almost certainly invented by a sadistic psychiatrist. At 36 letters, it’s longer than any of the words mentioned above and it means (I almost can’t believe it) the fear of long words. Only a sadistic psychiatrist would concoct such a word to describe the fear of such long words. I mean, how is that preferable longwordophobia?
  3. Circumbilivagination. I knew I would have to include some relatively short words, and at 20 letters this one is somewhat hippopotomonstrosesquippediliously challenged. It means; to move in a circle or walk around. There is a plethora of words that have the same or a similar meaning like; to circle, to orbit, to wheel, to whirl, to circuit, to rotate, to revolve, to circumambulate, to circumgyrate and to circumnavigate. That’s why circumbilivagination rarely comes up in conversation.
  4. Honorificabilitudinitatibus. This is a Shakespearean contribution, in the sense that Shakespeare is purported to have spoiled some perfectly good paper with this word. It means the state of being able to achieve honors. Presumably just before the 2008 Beijing Olympics, Michael Phelps was honorificabilitudinitatibic. To be honest, I’m not sure whether Shakespeare used this word in a play, a sonnet or a blog posting.
  5. Cholangiocholecystocholedochectomy. I’m not really sure that this qualifies as a genuine long word. It has 34 letters and it refers to the medical procedure of cutting out of the hepatic duct, the common bile duct, and the gall bladder. I really don’t believe this word ever gets used in conversations with surgeons. My uncle was a heart surgeon and I never heard him use it.

Having now listed 5 words, I think it’s time to state some of the principles I’m applying here. I really do believe that some words can’t be counted as long words if they are too specialized, so the last one doesn’t really count. I mean I could have thrown in pneumonoultramicroscopicsilicovolcanoconiosis (45 letters and a coal-mining disease) but that doesn’t meet the standard. There are probably shed loads of chemical names that stretch “to infinity and beyond” that would vote themselves onto this list if I let them.

Pages: 1 2

{ 7 comments… read them below or add one }

Leon Segtuat May 24, 2012 at 20:01

Um, hello? You never put the longest one on there. Look up “titin full name.” That’s the longest word.

Reply

Leon Segtuat May 26, 2012 at 12:05

I’m really sorry for my manners in that last comment. I wasn’t thinking. Will you forgive me?

Reply

anonymous July 3, 2012 at 23:34

Correct me if I’m wrong, but the chemical name for titin is not in any dictionary I know of and therefore probably not a real word – it has been argued over many times.

P.S. I’m not in high school yet.

Reply

Robin Bloor July 10, 2012 at 20:33

I personally favor the dismissal of such constructions as English words. One might just as well accept the value of pi to 1000 decimal places as a long word. A longer word would be pi to 1001 decimal places. If you don’t accept decimal digits as letters then try a genome sequence like ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAA
This has meaning and consists of letters.
You have to draw aline somewhere…

Reply

Gregg Taylor September 24, 2012 at 22:41

The definition for Hippopotomonstrosesquippediliophobia just cracked me up. Mostly because I had just seen the word Hippopotomonstrosesquipedalian and correctly pronounced it, I am still laughing because of the irony of the word Hippopotomonstrosesquippediliophobia and its definition.

Reply

Anonymous January 9, 2013 at 20:07

These words are not really in my interest. I was looking for more “meaningful” words.
For example, I am pretty sure most people have heard of supercalifraglisticexpialodocious, which isn’t a word at all.
It is just a phrase that came from the movie Mary Popins.
I was looking for words to grow my vocabulary, not make me sound like a idiot.
Most if these words have no actual meaning.

Reply

kolin stovall February 20, 2013 at 15:36

i need longer words

Reply

Leave a Comment

Previous post:

Next post: